Primer Design Assessment (REaletd with medical microbiology, real time PCR)

Click here to order this assignment @Essayfix.net 100% Original.Written from scratch by professional writers.

I have uploaded 2 documents here. One of them is the guidance – What my professor want me to write and one of them is a specific for me which I have to write my essay based on this sample inside the paper. This assignment is related with Molecular Diagnostics- PCR- Primer Design. Here is the explanation of the essay : Molecular Diagnostics Written Assessment Design and optimisation of a real-time PCR A group of students have been asked to design primers to detect either HSV-1 or HSV-2 and they followed the same procedure that you have carried out during the primer design workshop using the same reference sequences and variants sequences for HSV-1 or HSV-2. Another set of primers were designed by the lab staff to detect both HSV-1 and HSV-2. The students designed primers were assessed in comparison with the lab designed primers using conditions optimal for the lab designed primers. The two sets of primers were tested against samples containing HSV-1, HSV-2 and controls using the SYBR Green real- time assay protocol which is available in the practical sessions manual on blackboard. There is also a video recording for this experiment. You have been provided with results from this real-time PCR assay (Ct values, Tms, amplification curve and melting curve). In addition, you have been given the sequences of the students set of primers that generated your results. The lab designed primers sequences are: HSVForward GACAGCGAATTCGAGATGCTG HSVReverse ATGTTGTACCCGGTCACGAACT You are asked to write any essay to: (a) Evaluate the design of both sets of primers. (b) Discuss the results from the SYBR Green assay comparing the results of students and lab designed primers. (c) Discuss what parameters you would change in response to these results. (d) Suggest what steps are required before this assay can be used in a diagnostic laboratory. You should provide discussion and support your report by appropriate references. The word limit for this assignment is 1500 words (+/- 10%), not including references and figure legends. Tables are included in the word count. You will be penalised for going over the word limit but no penalties for going under the word limit

Click here to order this assignment @Essayfix.net 100% Original.Written from scratch by professional writers.